| Primary Identifier | MGI:6115009 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zfp597 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTATGCCTTGTCCACACTGG, ATGGAACTTTCATCAGTTCT, CAAGCCATAGAGTTCCCCCA and TTTCGCCTTAGAATGCGGAG, which resulted in a 329 bp deletion beginning at Chromosome 16 negative strand position 3,871,404 bp and ending after 3,871,076 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001313389 (exon 2) and 202 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 11 and early truncation 11 amino acids later. |
