|  Help  |  About  |  Contact Us

Allele : Fbxo21<em1(IMPC)J> F-box protein 21; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6159262 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Fbxo21
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project Fbxo21-113150J-9663M was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGCCAGGTCTGAATGTGCCG, TTTGTGTACACCTACTCCCG, GCCTCAACCATGAGTTAGCG and CTTCACCAGGATAACTGCAG, which resulted in a 305 bp deletion beginning at Chromosome 5 position 117,979,701 bp and ending after 117,980,005 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000291184 (exon 3) and 210 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a single base (G) insertion at the deletion site that will not alter the results of the deletion. This deletion is predicted to cause a change of amino acid sequence after residue 125 and early truncation 23 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories