|  Help  |  About  |  Contact Us

Allele : Gckr<em1(IMPC)H> glucokinase regulatory protein; endonuclease-mediated mutation 1, Harwell

Primary Identifier  MGI:6149158 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Gckr
Strain of Origin  C57BL/6N Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and 4 guide sequences CCAGTGTGTTCATGGCGGAGCCA, TCCACAAAACCCAGTAAAGTTGG, CCAGCCCCCAAATGTCTTTTTAG, TTAGTCTCCAACATCCCTTGTGG, which resulted in a 1262 nt deletion in exons ENSMUSE00000487442 and ENSMUSE00000486780.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

9 Publication categories