|  Help  |  About  |  Contact Us

Allele : Krt25<em1(IMPC)J> keratin 25; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6151423 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Krt25
Inheritance Mode  Not Specified Strain of Origin  Not Specified
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGAGAGGCCAGCCTTAGCCG, GTGAGCGAAAAGAATCCATG, GCATGCTACATGATTACTAG and TTAAGGGCATTTAAGGGCAT, which resulted in a 357 bp deletion beginning at Chromosome 11 position 99,321,844 bp and ending after 99,322,200 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000972994 (exon 2) and 274 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 10 bp deletion (ATCCCTTAAA) 160 bp after the 357 bp deletion, that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 139 and early truncation 13 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories