|  Help  |  About  |  Contact Us

Allele : Gcsh<em1(IMPC)H> glycine cleavage system protein H (aminomethyl carrier); endonuclease-mediated mutation 1, Harwell

Primary Identifier  MGI:6153793 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Gcsh
Strain of Origin  C57BL/6NTac Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and 4 guide sequences CCCAAGTTCAAGACCTAGCTGGG, AGGCTAGAGCCGTACCTCAGTGG, AACACACTTTCCCCACTCGGAGG, ACTTTCCCCACTCGGAGGTCTGG, which resulted in an Exon Deletion. The allele carries a 643 base pair deletion that encompasses the entire exon 3, creating a frame-shift after exon 2 (amino acid 73) and is predicted to be a null allele.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Gcsh<->,
  • Gcsh<->
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

0 Driven By

7 Publication categories