| Primary Identifier | MGI:6153793 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Gcsh |
| Strain of Origin | C57BL/6NTac | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and 4 guide sequences CCCAAGTTCAAGACCTAGCTGGG, AGGCTAGAGCCGTACCTCAGTGG, AACACACTTTCCCCACTCGGAGG, ACTTTCCCCACTCGGAGGTCTGG, which resulted in an Exon Deletion. The allele carries a 643 base pair deletion that encompasses the entire exon 3, creating a frame-shift after exon 2 (amino acid 73) and is predicted to be a null allele. |
