| Primary Identifier | MGI:6156434 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rttn |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0563 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of TAGAAGAGATCCTATGAGAC and GCTATACTCTAGAGAAAGAC targeting the 5' side and ACTACAAACAATCATCCGGA and GGTATTATCCAATGGGGTAG targeting the 3' side of exons ENSMUSE00000385993 and ENSMUSE00000365998, resulting in a 2,002 bp deletion of Chr18 from 88973127 to 88975128_insT. (GRCm38). |
