|  Help  |  About  |  Contact Us

Allele : Rttn<em1(IMPC)Tcp> rotatin; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156434 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Rttn
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0563 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of TAGAAGAGATCCTATGAGAC and GCTATACTCTAGAGAAAGAC targeting the 5' side and ACTACAAACAATCATCCGGA and GGTATTATCCAATGGGGTAG targeting the 3' side of exons ENSMUSE00000385993 and ENSMUSE00000365998, resulting in a 2,002 bp deletion of Chr18 from 88973127 to 88975128_insT. (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

5 Publication categories