| Primary Identifier | MGI:6156467 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Usp29 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0502 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with the spacer sequences TCCTGTTTGTGCTGCGGATC, TGATAATGTTACAGGCGTAG, GATCTGAACTCTCGAACACT, and TAACGGCCTTACATACATCC. This resulted in a 2607 bp deletion of Chr7 from 6961151 to 6963757. This mutation is predicted to cause a frameshift with the amino acid changes after residue 7 and early truncation (p.R7F*fs1). (GRCm38). |