| Primary Identifier | MGI:6156472 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Trim13 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR1020 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GGAATGTGCGGAATTCCCTG targeting the 5' side and AGTTATGCAAACCTATGACC targeting the 3' side of a critical exon. This resulted in a 511-bp deletion Chr14:61604671 to 61605181; p.L46Tfs*45 resulting in a frameshift mutation in all annotated full length protein-coding transcripts (GRCm38). |