|  Help  |  About  |  Contact Us

Allele : Nexmif<em1(IMPC)Tcp> neurite extension and migration factor; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156555 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Nexmif
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0641 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of ATCACTGGTATAGGCTGGAT and ATGATCGGGTGCTTCAATCA targeting the 5' side and GGCAGATCGAGAGTCCTCAC and AAAGCGCGTGGAACGAGAAC targeting the 3' side of a critical region. This resulted in a 4,030-bp deletion of ChrX from 104084031 to 104088060. (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

0 Driven By

5 Publication categories