| Primary Identifier | MGI:6156573 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tmem74 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0740 was generated at The Centre for Phenogenomics by injecting Cas9 ribonucleoprotein complexes with three guide RNAs containing spacer sequences of AGTGGACCCATGCAATGCTT and CAAACAAGCTTCTCCCTATC targeting the 5' side and TCTGGAACTGTCCTTGGTAG targeting the 3' side of exon ENSMUSE00000452230 resulting in a 909-bp deletion of Chr15 from 43866755 to 43867663 (GRCm38). |