|  Help  |  About  |  Contact Us

Allele : Tmem74<em1(IMPC)Tcp> transmembrane protein 74; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156573 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Tmem74
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0740 was generated at The Centre for Phenogenomics by injecting Cas9 ribonucleoprotein complexes with three guide RNAs containing spacer sequences of AGTGGACCCATGCAATGCTT and CAAACAAGCTTCTCCCTATC targeting the 5' side and TCTGGAACTGTCCTTGGTAG targeting the 3' side of exon ENSMUSE00000452230 resulting in a 909-bp deletion of Chr15 from 43866755 to 43867663 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

Trail: Allele

0 Driven By

5 Publication categories

Trail: Allele