|  Help  |  About  |  Contact Us

Allele : Cdc23<em1(IMPC)J> CDC23 cell division cycle 23; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6157342 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cdc23
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGTCATCCATCTCTACCCGA, TTATTAATAAAACCAGCAGC, AAGCAAGCATGATTCAAGCG and AGGCGGATGTTGTTTTGCTT, which resulted in a 270 bp deletion beginning at Chromosome 18 position 34,644,966 bp and ending after 34,645,235 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001208921 (exon 4) and 227 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 7 bp insertion (GTCTATA) at the deletion site that will not alter the results of the exon deletion. This deletion is predicted to cause a change of amino acid sequence after residue 124 and early truncation 2 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories