| Primary Identifier | MGI:6157342 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Cdc23 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGTCATCCATCTCTACCCGA, TTATTAATAAAACCAGCAGC, AAGCAAGCATGATTCAAGCG and AGGCGGATGTTGTTTTGCTT, which resulted in a 270 bp deletion beginning at Chromosome 18 position 34,644,966 bp and ending after 34,645,235 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001208921 (exon 4) and 227 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 7 bp insertion (GTCTATA) at the deletion site that will not alter the results of the exon deletion. This deletion is predicted to cause a change of amino acid sequence after residue 124 and early truncation 2 amino acids later. |
