|  Help  |  About  |  Contact Us

Allele : Esrp2<em1(IMPC)Tcp> epithelial splicing regulatory protein 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156498 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Esrp2
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR1034 was generated at The Centre for Phenogenomics by injecting Cas9 ribonucleoprotein complexes and single guide RNA(s) with spacer sequences of TGGGCAGCAGCTGTTGCGAC and TTCTCTGCGGAGGTCGTAGA targeting the 5' side and CACGCTCCACCGACATCATC and ATATAGTGCTGTCGTCTCTG targeting the 3' side of a critical region. This resulted in a 2118-bp del Chr8:106132572 to 106134689 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

5 Publication categories