| Primary Identifier | MGI:6156498 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Esrp2 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR1034 was generated at The Centre for Phenogenomics by injecting Cas9 ribonucleoprotein complexes and single guide RNA(s) with spacer sequences of TGGGCAGCAGCTGTTGCGAC and TTCTCTGCGGAGGTCGTAGA targeting the 5' side and CACGCTCCACCGACATCATC and ATATAGTGCTGTCGTCTCTG targeting the 3' side of a critical region. This resulted in a 2118-bp del Chr8:106132572 to 106134689 (GRCm38). |
