|  Help  |  About  |  Contact Us

Allele : Phip<em1(IMPC)Tcp> pleckstrin homology domain interacting protein; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6156509 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Phip
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0832 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TACCACATTATCTTCACAAC and GGATGAAATACTTTCAGGCT targeting the 5' side and ACTATGTTGTGATGTCCTCT and AAGTTACATGTTGAGTTAAT targeting the 3' side of a critical region. This resulted in a 3,149-bp deletion of Chr9 from 82959244 to 82962392 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

0 Driven By

5 Publication categories