| Primary Identifier | MGI:6156509 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Phip |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0832 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TACCACATTATCTTCACAAC and GGATGAAATACTTTCAGGCT targeting the 5' side and ACTATGTTGTGATGTCCTCT and AAGTTACATGTTGAGTTAAT targeting the 3' side of a critical region. This resulted in a 3,149-bp deletion of Chr9 from 82959244 to 82962392 (GRCm38). |