| Primary Identifier | MGI:6208800 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Avpr1a |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGGAGGCTGGAGAAATTCCG and TAGAAGCTTAACTATTGAAT, which resulted in a 1550 bp deletion beginning at Chromosome 10 position 122,448,382 bp and ending after 122,449,931 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000100823 (exon 1) and 259 bp of flanking intronic sequence including the start of translation and splice donor and is predicted to result in a null allele. |
