| Primary Identifier | MGI:6257708 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zfp804a |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele from project TCPR0985 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CACTATTGCCAAAGCTCTGG targeting the 5' side and ATATGACCACGCCCACAAAC targeting the 3' side of a critical region. This resulted in a 102 bp-del Chr2:82235835 to 82235936; in-frame intra-exon deletion deleting amino acids 50-85. The Pfam zinc finger double-stranded RNA binding domain is annotated from amino acid 57-84 amino acids in Ensembl build 38, so this domain is completely removed by this deletion. |
