|  Help  |  About  |  Contact Us

Allele : Zfp804a<em1(IMPC)Tcp> zinc finger protein 804A; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6257708 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Zfp804a
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NCrl
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project TCPR0985 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CACTATTGCCAAAGCTCTGG targeting the 5' side and ATATGACCACGCCCACAAAC targeting the 3' side of a critical region. This resulted in a 102 bp-del Chr2:82235835 to 82235936; in-frame intra-exon deletion deleting amino acids 50-85. The Pfam zinc finger double-stranded RNA binding domain is annotated from amino acid 57-84 amino acids in Ensembl build 38, so this domain is completely removed by this deletion.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

3 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele