|  Help  |  About  |  Contact Us

Allele : Snx6<em1(IMPC)J> sorting nexin 6; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6259581 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Snx6
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATGACTGAGGCCTTATAAA and GTTCGTTAAAGTTAGTTATT, which resulted in a 391 bp deletion beginning at Chromosome 12 position 54,770,473 bp and ending after 54,770,863 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000532238 (exon 5) and 269 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause an early truncation after amino acid 90.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories