| Primary Identifier | MGI:6259581 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Snx6 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATGACTGAGGCCTTATAAA and GTTCGTTAAAGTTAGTTATT, which resulted in a 391 bp deletion beginning at Chromosome 12 position 54,770,473 bp and ending after 54,770,863 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000532238 (exon 5) and 269 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause an early truncation after amino acid 90. |