| Primary Identifier | MGI:6259891 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Pold4 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTGGATGGCAAAGGCAAAT and CCCTACGTAGACCAAGAGGG, which resulted in a 2-part deletion beginning at Chromosome 19 position 4,232,361 bp for 446 bp, followed by 5 bp of retained sequence (TGGGT), then an additional 110 bp deletion that ends after 4,232,921 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000145535 and ENSMUSE00000145533 (exons 2 and 3) and 355 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 32 and early truncation 20 amino acids later. |
