|  Help  |  About  |  Contact Us

Allele : Pold4<em1(IMPC)J> polymerase (DNA-directed), delta 4; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6259891 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Pold4
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTGGATGGCAAAGGCAAAT and CCCTACGTAGACCAAGAGGG, which resulted in a 2-part deletion beginning at Chromosome 19 position 4,232,361 bp for 446 bp, followed by 5 bp of retained sequence (TGGGT), then an additional 110 bp deletion that ends after 4,232,921 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000145535 and ENSMUSE00000145533 (exons 2 and 3) and 355 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 32 and early truncation 20 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

4 Publication categories

Trail: Allele