| Primary Identifier | MGI:6306478 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Peak1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTTACTGTACATAAAGACG and ACTTTTGAATACAAATTTGA, which resulted in a 250 bp deletion beginning at Chromosome 9 position 56,241,119 bp and ending after 56,241,368 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000352103 (exon 5) and 65 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 775 and early truncation 284 amino acids later. |
