|  Help  |  About  |  Contact Us

Allele : Orc2<em1(IMPC)J> origin recognition complex, subunit 2; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6284488 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Orc2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACCAAACTCATCAAATTCCG and GTTGTACTCTTAATGTAGGT, which resulted in a 1259 bp deletion beginning at Chromosome 1 position 58,492,609 bp. There is a 6 bp endogenous retention (CTACAT) after 58,493,784 followed by 74 bp of the deletion and ending after 58,493,873 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000155147 and ENSMUSE00000238668 (exons 6 and 7) and 1137 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 109 and early truncation 2 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Orc2<->,
  • Orc2<->
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

5 Publication categories