| Primary Identifier | MGI:6284488 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Orc2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACCAAACTCATCAAATTCCG and GTTGTACTCTTAATGTAGGT, which resulted in a 1259 bp deletion beginning at Chromosome 1 position 58,492,609 bp. There is a 6 bp endogenous retention (CTACAT) after 58,493,784 followed by 74 bp of the deletion and ending after 58,493,873 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000155147 and ENSMUSE00000238668 (exons 6 and 7) and 1137 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 109 and early truncation 2 amino acids later. |
