| Primary Identifier | MGI:6316160 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Adamtsl3 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR837 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with 4 single guide RNA(s) with spacer sequences of CACTTTAATCTAAGGCAAGA and GATTGCTGTAGGGCCATTGC targeting the 5' side and GTGATACCTACAGCATTCGG and GGTAGGACTTGTCTAAACAC targeting the 3' side of exon ENSMUSE00000591449 resulting in a 218-bp deletion Chr7:82575906 to 82576123_insTGTGGTGCA and 21-bp deletion Chr7:82576215 to 82576235_insA (GRCm38). |
