|  Help  |  About  |  Contact Us

Allele : Pebp1<em3(IMPC)Tcp> phosphatidylethanolamine binding protein 1; endonuclease-mediated mutation 3, The Centre for Phenogenomics

Primary Identifier  MGI:6316205 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Pebp1
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0388 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and four guide RNAs with spacer sequences of TTTTAGTAGCGGCCATACTT and GAATTACCACTAATCTGCAT targeting the 5' side and GGCTATCTATCATCCGGACA and ATTCTGCCGTCCTTACAGTA targeting the 3' side of exons ENSMUSE00000292490 and ENSMUSE00000292484 resulting in a 813 bp deletion of Chr5 from 117285619 to 117286432 (GRCm38). This mutation is predicted to cause a frameshift with the amino acid changes after residue 47 and early truncation 11 amino acids later (p.M47Sfs*13).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories