|  Help  |  About  |  Contact Us

Allele : Ptp4a1<em3(IMPC)Tcp> protein tyrosine phosphatase 4a1; endonuclease-mediated mutation 3, The Centre for Phenogenomics

Primary Identifier  MGI:6316206 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ptp4a1
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0379 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and two guide RNAs with spacer sequences of ATGCTACGTGTTATGTTGGG targeting the 5' side and AGTCCTGTCCTGCATGCAGG targeting the 3' side of OTTMUSE00000245667 and OTTMUSE00000245014. Two single-strand oligonucleotides were also injected to introduce loxP sites. Subsequent NHEJ-mediated repair resulted in c.106_329del. This mutation is predicted to cause a frameshift with the amino acid changes after residue 36 and early truncation 7 amino acids later (p.E36S*fs9).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories