|  Help  |  About  |  Contact Us

Allele : Qki<em2Tcp> quaking, KH domain containing RNA binding; endonuclease-mediated mutation 2, The Centre for Phenogenomics

Primary Identifier  MGI:6316208 Allele Type  Endonuclease-mediated
Attribute String  Conditional ready, No functional change Gene  Qki
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false
molecularNote  This allele from project TCPR0749 was generated at The Centre for Phenogenomics by injecting Cas9 ribonucleotproing complexes with two single guide RNAs with the spacer sequences TGCCTCAGCAAGATTTAAAC and GGTTCAAGCTATGGATTCTG along with a long single-strand DNA template with loxP sites inserted at the Cas9 cut sites flanking exon ENSMUSE00000269846.
  • mutations:
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories