| Primary Identifier | MGI:6316208 | Allele Type | Endonuclease-mediated |
| Attribute String | Conditional ready, No functional change | Gene | Qki |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | This allele from project TCPR0749 was generated at The Centre for Phenogenomics by injecting Cas9 ribonucleotproing complexes with two single guide RNAs with the spacer sequences TGCCTCAGCAAGATTTAAAC and GGTTCAAGCTATGGATTCTG along with a long single-strand DNA template with loxP sites inserted at the Cas9 cut sites flanking exon ENSMUSE00000269846. |
