| Primary Identifier | MGI:6316218 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Syt9 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele from project TCPR0867 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GAGCTTGTTCATATAAATCT and CGAGGCTTAAAAATGAGGCC targeting the 5' side and TTGACAACCAAGTGCTTGCG and CGTCAACCACTCCCAAGCTC targeting the 3' side leading to a 2,313-bp deletion Chr7:107434925 to 107437237 (GRCm38) resulting in a frameshift mutation in all annotated full length protein-coding transcripts. |
