|  Help  |  About  |  Contact Us

Allele : Syt9<em2(IMPC)Tcp> synaptotagmin IX; endonuclease-mediated mutation 2, The Centre for Phenogenomics

Primary Identifier  MGI:6316218 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Syt9
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0867 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of GAGCTTGTTCATATAAATCT and CGAGGCTTAAAAATGAGGCC targeting the 5' side and TTGACAACCAAGTGCTTGCG and CGTCAACCACTCCCAAGCTC targeting the 3' side leading to a 2,313-bp deletion Chr7:107434925 to 107437237 (GRCm38) resulting in a frameshift mutation in all annotated full length protein-coding transcripts.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele