|  Help  |  About  |  Contact Us

Allele : Wnk3<em3(IMPC)Tcp> WNK lysine deficient protein kinase 3; endonuclease-mediated mutation 3, The Centre for Phenogenomics

Primary Identifier  MGI:6316231 Allele Type  Endonuclease-mediated
Attribute String  Not Specified Gene  Wnk3
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele from project TCPR0565 was generated at The Centre for Phenogenomics by injecting Cas9 mRNA and a single guide RNA with a spacer sequence of ATTTCAGCGGGGTCGGTTCC along with a lacZ target vector. The lacZ was not incorporated into the allele and instead non-homologous end-joining repair resulted in an indel at ChrX:151294546-151294547_delGT (GRCm38).
  • mutations:
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

2 Publication categories