|  Help  |  About  |  Contact Us

Allele : Fblim1<em3(IMPC)Tcp> filamin binding LIM protein 1; endonuclease-mediated mutation 3, The Centre for Phenogenomics

Primary Identifier  MGI:6316179 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Fblim1
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele produced from project TCPR0328 at TCP by injecting Cas9 mRNA and one guide RNA with the spacer sequence CTTGTGAAGCCAGACGCGCT and a single-strand oligonucleotide encoding a point mutation. This allele was repaired by NHEJ resulting in a 8-bp deletion (GCGTCTGG) and 1-bp insertion at Chr4:141595354-141595361_insC (GRCm38).
  • mutations:
  • Intragenic deletion,
  • Insertion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories