| Primary Identifier | MGI:6316179 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Fblim1 |
| Strain of Origin | C57BL/6NCrl | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele produced from project TCPR0328 at TCP by injecting Cas9 mRNA and one guide RNA with the spacer sequence CTTGTGAAGCCAGACGCGCT and a single-strand oligonucleotide encoding a point mutation. This allele was repaired by NHEJ resulting in a 8-bp deletion (GCGTCTGG) and 1-bp insertion at Chr4:141595354-141595361_insC (GRCm38). |
