|  Help  |  About  |  Contact Us

Allele : Eif5b<em1(IMPC)J> eukaryotic translation initiation factor 5B; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6324040 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Eif5b
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTCATCCCTTAAAGGTCATG and AGAAGGCTCTGGTTCATGTT, which resulted in a 800 bp deletion beginning at Chromosome 1 position 38,018,772 bp and ending after 38,019,571 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000340970 (exon 4) and 130 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 82 and early truncation 75 amino acids later.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Eif5b<->,
  • Eif5b<->
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

5 Publication categories