|  Help  |  About  |  Contact Us

Allele : Slc30a2<em1(IMPC)Tcp> solute carrier family 30 (zinc transporter), member 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:6324180 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Slc30a2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NCrl
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele from project TCPR1286 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TGTACCCAGACATCGTTGGT and GGGCCTACCCACTCCACGAT targeting the 5' side and ATCAGAACTCATAACCTCGG and TCTGGTATAAAGCTGGTTAT targeting the 3' side of a critical region. This resulted in a 681-bp del Chr4: 134347149 to 134347829 (GRCm38).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

0 Driven By

4 Publication categories