|  Help  |  About  |  Contact Us

Allele : Cdc37<em1(IMPC)J> cell division cycle 37; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6361011 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cdc37
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAGATGGCAGATGGCCAGG and TCTGGTCCCCTGTGGTAGCA, which resulted in a 2,555 bp deletion beginning at Chromosome 9 position 21,140,717 bp and ending after 21,143,271 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000217364 through ENSMUSE00000217367 (exons 2-7) and 1673 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 34 due to the deletion of 295 amino acids but remains in frame for the last 50 amino acids. There is an additional 1bp (A) deletion 3 bp upstream of the deletion site.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Cdc37<->,
  • Cdc37<->
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

5 Publication categories