| Primary Identifier | MGI:6385698 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Znhit2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGAAATAACCAAAGAAGCGC and GTGGGTCCAAAAGTCTGACG, which resulted in a 1563 bp deletion beginning at Chromosome 19 position 6,061,172 bp and ending after 6,062,734 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000865022 (exon 1) and 282 bp of flanking intronic sequence including the splice acceptor, start site and donor and is predicted to generate a null allele. |
