|  Help  |  About  |  Contact Us

Allele : Znhit2<em1(IMPC)J> zinc finger, HIT domain containing 2; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6385698 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Znhit2
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGAAATAACCAAAGAAGCGC and GTGGGTCCAAAAGTCTGACG, which resulted in a 1563 bp deletion beginning at Chromosome 19 position 6,061,172 bp and ending after 6,062,734 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000865022 (exon 1) and 282 bp of flanking intronic sequence including the splice acceptor, start site and donor and is predicted to generate a null allele.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Znhit2<->,
  • Znhit2<->
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

6 Publication categories

Trail: Allele