| Primary Identifier | MGI:6380687 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Amigo2 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTTTGTGGCATCCACTTAGC and TTGACAGCTCTAGGCAGGGT, which resulted in a 1531 bp deletion beginning at Chromosome 15 position 97,244,981 bp and ending after 97,246,511 bp (GRCm38/mm10). This mutation deletes 1531 bp of ENSMUSE00000505071 (exon 2) and is predicted to cause a change of amino acid sequence after residue 9 and early truncation 23 amino acids later. |
