|  Help  |  About  |  Contact Us

Allele : Usp49<em1Gpt> ubiquitin specific peptidase 49; endonuclease-mediated mutation 1, GemPharmatech Co., Ltd

Primary Identifier  MGI:6403288 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Usp49
Strain of Origin  C57BL/6NGpt Is Recombinase  false
Is Wild Type  false
molecularNote  Exon 3 was targeted using two gRNAs (AGACCACATGACTCGGAAGAGGG and AGCCACGGAAGGCGGGAATCAGG) and CRISPR/Cas9 technology, resulting in a 182 bp deletion. This causes a frameshift and premature stop codon.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • Usp49<em1Cd182>,
  • Usp49<em1Cd182>,
  • Usp49<em1Nju>,
  • Usp49<->,
  • Usp49<->,
  • Usp49<em1Nju>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories