|  Help  |  About  |  Contact Us

Allele : Cmtm7<em1(IMPC)J> CKLF-like MARVEL transmembrane domain containing 7; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:6407420 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cmtm7
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTATACGCAGAGTATCCCA and GATTGTTGCAGCACATCGCA, which resulted in a 5299 bp deletion beginning at Chromosome 9 position 114,758,536 bp and ending after 114,763,834 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001047288, ENSMUSE00000219733 and ENSMUSE00001092044 (exons 2,3 and 4) and 4944 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 45 and early truncation 78 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

4 Publication categories