| Primary Identifier | MGI:6478808 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Amigo2 |
| Strain of Origin | C57BL/6J x DBA/2 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Deletions were created by targeting TALENs to TCAGGAATGTGCCCCACTGC and TTGGTGCAGCTGACAATGTC. Four mouse lines, with 2-bp, 8-bp, 22-bp, and 43-bp deletions, respectively, were selected for further breeding and experimental data from these four lines was pooled. The pound # sign in the allele symbol is used for this pooled allele. |
