|  Help  |  About  |  Contact Us

Allele : Cfap58<em1Fzh> cilia and flagella associated protein 58; endonuclease-mediated mutation 1, Feng Zhang

Primary Identifier  MGI:6477396 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cfap58
Is Recombinase  false Is Wild Type  false
molecularNote  Exon 10 was targeted with sgRNAs (CTGATCTCACAGCTTCATAC and GAACCTGTACAGCAAAAACC) using CRISPR/Cas9 technology, resulting in a 13bp/3bp deletion/insertion. Immunoblot experiments confirmed virtual absence of protein expression from this allele.
  • mutations:
  • Insertion,
  • Intragenic deletion
  • synonyms:
  • Cfap58-KO,
  • Cfap58-KO
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories