|  Help  |  About  |  Contact Us

Allele : Pole3<em3Tbo> polymerase (DNA directed), epsilon 3 (p17 subunit); endonuclease-mediated mutation 3, Thomas Boehm

Primary Identifier  MGI:6490635 Allele Type  Endonuclease-mediated
Gene  Pole3 Strain of Origin  FVB
Is Recombinase  false Is Wild Type  false
molecularNote  A deletion-insertion (delGinsTA) in the 3' end of the coding region was created using sgRNAs (targeting CGGGAGCAGAAAGGCAAG) and an ssODN template (CGGTTTGTCTAATTAAACCATAATATCCTGCTTCCTTACAGCGTACAGGCAGGAACAGAAGGGCAAGAAGGAGGCTTCGGAGCAAAAGAAGAAGGACAAAGACAAAAAGGA) with CRISPR/Cas9 technology. The resulting frameshift creates a moderate net positive charge on the normally negatively charged tail of the encoded peptide.
  • mutations:
  • Insertion,
  • Intragenic deletion
  • synonyms:
  • Pole3<m3>,
  • Pole3<m3>
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

0 Driven By

3 Publication categories