|  Help  |  About  |  Contact Us

Allele : Ythdf2<em1Jhha> YTH N6-methyladenosine RNA binding protein 2; endonuclease-mediated mutation 1, Jacob Hanna

Primary Identifier  MGI:6491614 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ythdf2
Transmission  Germline Strain of Origin  (C57BL/6 x 129S4/SvJae)F1
Is Recombinase  false Is Wild Type  false
molecularNote  Exon 3 was targeted with sgRNAs (targeting CTTACTTGAGCCCACAGGCA and ACAGAACCATTTTGTACTAG) using CRISPR/Cas9 technology, resulting in a 44 bp deletion. This allele occurs in conjunction with the HREF="http://www.informatics.jax.org/allele/MGI:6491613">Ythdf1em1Jhha, Ythdf1em3Jhha and Ythdf3em1Jhha alleles in the same ESC line.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories